|
VectorBuilder GmbH
empty vector (shnc ![]() Empty Vector (Shnc, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/empty+vectors+(sh-nc/empty+vector++shnc/pmc10276622-47-12-17 Average 90 stars, based on 1 article reviews
empty vector (shnc - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Open Medicine
Article Title: Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
doi: 10.1515/med-2023-0718
Figure Lengend Snippet: BMI1 overexpression reversed the effects of TM on the viability and apoptosis of MIHA cells. (a) The transfection efficiency of BMI1 overexpression plasmid, shBMI1, shBMI1#2, and shBMI1#3 was determined by qRT-PCR. GAPDH was employed as the internal control. (b–d) MIHA cells were transfected with NC, BMI1 overexpression plasmid, shBMI1, or shNC and then were treated with TM (5 µg/ml) for different times. (b) The viability of treated MIHA cells was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (c and d) The apoptosis of treated MIHA cells was analyzed by flow cytometry. +++ P < 0.001 vs NC. ** P < 0.01, *** P < 0.001 vs control. & P < 0.05, && P < 0.01 vs shNC. ‡‡ P < 0.01, ‡‡‡ P < 0.001 vs TM + NC. ω P < 0.05, ωω P < 0.01, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShBMI1: BMI1-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin. CCK-8: cell counting kit-8. qRT-PCR: quantitative reverse transcription polymerase chain reaction.
Article Snippet: The BMI1-specific short hairpin RNA (shBMI1, target sequences: ATTGATGCCACAACCATAATA) and the empty
Techniques: Over Expression, Transfection, Plasmid Preparation, Quantitative RT-PCR, CCK-8 Assay, Flow Cytometry, Standard Deviation, shRNA, Negative Control, Cell Counting, Reverse Transcription Polymerase Chain Reaction
Journal: Open Medicine
Article Title: Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
doi: 10.1515/med-2023-0718
Figure Lengend Snippet: BMI1 overexpression reversed the effects of TM on KAT2B/MLKL pathway-related proteins and apoptosis-related proteins in MIHA cells. MIHA cells were transfected with NC, BMI1 overexpression plasmid, shBMI1, or shNC and then were treated with TM (5 µg/ml) for 48 h. (a–e) The protein levels of BMI1, KAT2B, p-MLKL, and MLKL in treated MIHA cells were determined by Western blot. (f and g) The expression levels of apoptosis-related proteins (Bcl-2, Bax, and cleaved caspase-3) were determined by Western blot. GAPDH was exploited as the internal control. ** P < 0.01, *** P < 0.001 vs control. ‡ P < 0.05, ‡‡ P < 0.01, ‡‡‡ P < 0.001 vs TM + NC. ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShBMI1: BMI1-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin.
Article Snippet: The BMI1-specific short hairpin RNA (shBMI1, target sequences: ATTGATGCCACAACCATAATA) and the empty
Techniques: Over Expression, Transfection, Plasmid Preparation, Western Blot, Expressing, Standard Deviation, shRNA, Negative Control
Journal: Open Medicine
Article Title: Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
doi: 10.1515/med-2023-0718
Figure Lengend Snippet: MLKL knockdown reversed the effects of TM on viability and apoptosis of MIHA cells. (a) The transfection efficiency of shMLKL, shMLKL#2, and shMLKL#3 was determined by qRT-PCR. GAPDH was employed as the internal control. (b) The viability of treated MIHA cells was analyzed at 0, 12, 24, and 48 h by CCK-8 assay. (c and d) The apoptosis of treated MIHA cells was analyzed by flow cytometry. &&& P < 0.001 vs shNC. * P < 0.05, ** P < 0.01, *** P < 0.001 vs control. ω P < 0.05, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. MLKL: mixed lineage kinase domain-like pseudokinase. ShMLKL: MLKL-specific short hairpin RNA. shNC: shRNA negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin. CCK-8: cell counting kit-8. qRT-PCR: quantitative reverse transcription polymerase chain reaction.
Article Snippet: The BMI1-specific short hairpin RNA (shBMI1, target sequences: ATTGATGCCACAACCATAATA) and the empty
Techniques: Transfection, Quantitative RT-PCR, CCK-8 Assay, Flow Cytometry, Standard Deviation, shRNA, Negative Control, Cell Counting, Reverse Transcription Polymerase Chain Reaction
Journal: Open Medicine
Article Title: Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
doi: 10.1515/med-2023-0718
Figure Lengend Snippet: MLKL knockdown reversed the effects of TM on apoptosis-related proteins in MIHA cells. (a–c) The protein levels of KAT2B, p-MLKL, and MLKL in treated MIHA cells were determined by Western blot. (d–e) The expression levels of apoptosis-related proteins (Bcl-2, Bax, and cleaved caspase-3) were determined by Western blot. GAPDH was exploited as the internal control. *** P < 0.001 vs control. ωω P < 0.01, ωωω P < 0.001 vs TM + shNC. Quantified values were presented as mean ± standard deviation of at least three independent experiments. ShMLKL: MLKL-specific short hairpin RNA. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. TM: Tunicamycin.
Article Snippet: The BMI1-specific short hairpin RNA (shBMI1, target sequences: ATTGATGCCACAACCATAATA) and the empty
Techniques: Western Blot, Expressing, Standard Deviation, shRNA, Negative Control
Journal: Open Medicine
Article Title: Unfolded protein response inhibits KAT2B/MLKL-mediated necroptosis of hepatocytes by promoting BMI1 level to ubiquitinate KAT2B
doi: 10.1515/med-2023-0718
Figure Lengend Snippet: BMI1 mediated the ubiquitination of KAT2B. (a) The interaction between KAT2B and BMI1 was predicted by ubibrowser. R, RING (Really Interesting New Gene); C, C-terminal SOCS box; SO, single other; F, F-box; D, DWD box. The width of the red edge reflects the confidence of the interaction. (b) The interaction between KAT2B and BMI1 was determined by co-IP assay. (c and d) MIHA cells were transfected with NC or BMI1 overexpression plasmid and then were treated with 20 μM MG132 for 4 h. The protein level of KAT2B was determined by Western blot. (e and f) MIHA cells were transfected with shNC or shBMI1. After 24 h, the ubiquitination level of KAT2B was detected by ubiquitination assay. + P < 0.05, ++ P < 0.01 vs NC; &&& P < 0.001 vs shNC. NC: negative control. GAPDH: glyceraldehyde-3-phosphate dehydrogenase. shBMI1, BMI1-specific short hairpin RNA. shNC, negative control of shBMI1.
Article Snippet: The BMI1-specific short hairpin RNA (shBMI1, target sequences: ATTGATGCCACAACCATAATA) and the empty
Techniques: Co-Immunoprecipitation Assay, Transfection, Over Expression, Plasmid Preparation, Western Blot, Ubiquitin Assay, Negative Control, shRNA